Fedora Account System
Red Hat Associate
Red Hat Customer
Spec URL: http://jkaluza.fedorapeople.org/ncbi-blast+.spec SRPM URL: http://jkaluza.fedorapeople.org/ncbi-blast+-2.2.28-1.fc19.src.rpm Description: The NCBI Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches. BLAST can be used to infer functional and evolutionary relationships between sequences as well as help identify members of gene families. Fedora Account System Username: jkaluza
rpmlint output: [hanzz@localhost results]$ rpmlint *.rpm ncbi-blast+.src: W: spelling-error %description -l en_US nucleotide -> nucleation ncbi-blast+.src:47: W: configure-without-libdir-spec ncbi-blast+.x86_64: W: spelling-error %description -l en_US nucleotide -> nucleation ncbi-blast+.x86_64: W: no-manual-page-for-binary psiblast ncbi-blast+.x86_64: W: no-manual-page-for-binary dustmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary update_blastdb.pl ncbi-blast+.x86_64: W: no-manual-page-for-binary convert2blastmask ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdb_aliastool ncbi-blast+.x86_64: W: no-manual-page-for-binary legacy_blast.pl ncbi-blast+.x86_64: W: no-manual-page-for-binary makeblastdb ncbi-blast+.x86_64: W: no-manual-page-for-binary makembindex ncbi-blast+.x86_64: W: no-manual-page-for-binary blast_formatter ncbi-blast+.x86_64: W: no-manual-page-for-binary windowmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary tblastn ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdbcheck ncbi-blast+.x86_64: W: no-manual-page-for-binary tblastx ncbi-blast+.x86_64: W: no-manual-page-for-binary blastx ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdbcmd ncbi-blast+.x86_64: W: no-manual-page-for-binary segmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary blastp ncbi-blast+.x86_64: W: no-manual-page-for-binary blastn ncbi-blast+.x86_64: W: no-manual-page-for-binary makeprofiledb ncbi-blast+.x86_64: W: no-manual-page-for-binary rpsblast ncbi-blast+.x86_64: W: no-manual-page-for-binary rpstblastn ncbi-blast+.x86_64: W: no-manual-page-for-binary deltablast 3 packages and 0 specfiles checked; 0 errors, 25 warnings. There are no manpages for those binaries provided by upstream. > ncbi-blast+.src:47: W: configure-without-libdir-spec This is expected, see the comment in specfile for more info.
To do quick test of the package, you can run following: echo GCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAAAGGATGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGTCCGGAGTATTGGGACCGGGAGACACGGAACATGAAGACCGAGACACAGAATGCCCCAGTGAACCTGCGGACCCTGCTCCGCTACTACAACCAGAGCGA > x echo TCGCTCTGGTTGTAGTAGCGGAGCAGGGTCCGCAGGTTCACTGGGGCATTCTGTGTCTCGGTCTTCATGTTCCGTGTCTCCCGGTCCCAATACTCCGGACCCTCCTGCTCCACCCACGGCGCCCGCGGCTCCATCCTTTGGCTCGCGGCGTCGCTGTCGAACCGCACGAACTGCGTGTCGTCCACGTAGC > y blastn -query x -subject y
# Remove executable mode from header files find c++ -type f -name *.h -exec chmod -x {} \; find c++ -type f -name *.hpp -exec chmod -x {} \; find c++ -type f -name *.cpp -exec chmod -x {} \; This should be done in %prep. ** Jaroslav: if you are reviewing, please set the fedora_review flag to ? and assign the bug to yourself.
Fixed. I think that if you want to review the package, you can freely take it.
Package Review ============== Legend: [x] = Pass, [!] = Fail, [-] = Not applicable, [?] = Not evaluated [ ] = Manual review needed Issues: ======= - Packages have proper BuildRequires/Requires on jpackage-utils See: https://fedoraproject.org/wiki/Packaging:Java Not applicable, java is not packaged. - Javadocs are placed in %{_javadocdir}/%{name} (no -%{version} symlink) Note: No javadoc subpackage present See: https://fedoraproject.org/wiki/Packaging:Java#Javadoc_installation Not applicable, java is not packaged. - Javadoc documentation files are generated and included in -javadoc subpackage Note: No javadoc subpackage present See: https://fedoraproject.org/wiki/Packaging:Java#Javadoc_installation Not applicable, java is not packaged. - Bundled jar/class files should be removed before build Note: Jar files in source (see attachment) See: http://fedoraproject.org/wiki/Packaging:Java#Pre-built_JAR_files_.2F_Other_bundled_software' It is not packed, but I would prefer to rm it in the %prep. ===== MUST items ===== C/C++: [x]: Package does not contain kernel modules. [x]: Package contains no static executables. [-]: Development (unversioned) .so files in -devel subpackage, if present. Note: Unversioned so-files in private %_libdir subdirectory (see attachment). Verify they are not in ld path. [x]: Package does not contain any libtool archives (.la) [x]: Rpath absent or only used for internal libs. Generic: [x]: Package is licensed with an open-source compatible license and meets other legal requirements as defined in the legal section of Packaging Guidelines. [x]: %build honors applicable compiler flags or justifies otherwise. [x]: Package contains no bundled libraries without FPC exception. - The sources bundle zlib, bzip2, it seems they are not used, but I would rm them in the %prep. [x]: Changelog in prescribed format. [x]: Sources contain only permissible code or content. - The non permissible content is not packaged, but I would prefer to run 'rm' on it in the %prep, to be sure it cannot be accidentaly packaged later. [-]: Package contains desktop file if it is a GUI application. [-]: Development files must be in a -devel package [-]: Package requires other packages for directories it uses. [x]: Package uses nothing in %doc for runtime. [x]: Package is not known to require ExcludeArch. [x]: Package complies to the Packaging Guidelines [x]: License field in the package spec file matches the actual license. Note: Checking patched sources after %prep for licenses. Licenses found: "Unknown or generated", "MIT/X11 (BSD like)", "BSL (v1.0)", "LGPL (v2 or later) (with incorrect FSF address)", "zlib/libpng", "*No copyright* BSD (3 clause)", "BSD (3 clause)". 2543 files have unknown license. Detailed output of licensecheck in /home/yarda/git-fedora/ncbi-blast/review-ncbi- blast+/licensecheck.txt - It seems the packaged content is under correct licenses. I would recommend to remove the other content in %prep to be sure we do not ship the content with different licenses. [x]: Package consistently uses macro is (instead of hard-coded directory names). [x]: If the package is under multiple licenses, the licensing breakdown must be documented in the spec. [x]: Package is named according to the Package Naming Guidelines. [x]: Package does not generate any conflict. [x]: Package obeys FHS, except libexecdir and /usr/target. [-]: If the package is a rename of another package, proper Obsoletes and Provides are present. [x]: Package must own all directories that it creates. [x]: Package does not own files or directories owned by other packages. [x]: Requires correct, justified where necessary. [x]: Spec file is legible and written in American English. [-]: Package contains systemd file(s) if in need. [x]: Useful -debuginfo package or justification otherwise. [-]: Large documentation must go in a -doc subpackage. Note: Documentation size is 20480 bytes in 3 files. [x]: All build dependencies are listed in BuildRequires, except for any that are listed in the exceptions section of Packaging Guidelines. [x]: Package does not run rm -rf %{buildroot} (or $RPM_BUILD_ROOT) at the beginning of %install. [x]: Each %files section contains %defattr if rpm < 4.4 [x]: Macros in Summary, %description expandable at SRPM build time. [x]: Package does not contain duplicates in %files. [x]: Permissions on files are set properly. [x]: Fully versioned dependency in subpackages, if present. [x]: If (and only if) the source package includes the text of the license(s) in its own file, then that file, containing the text of the license(s) for the package is included in %doc. [x]: Package use %makeinstall only when make install' ' DESTDIR=... doesn't work. [x]: Package is named using only allowed ASCII characters. [x]: Package do not use a name that already exist [x]: Package is not relocatable. [x]: Sources used to build the package match the upstream source, as provided in the spec URL. [x]: Spec file name must match the spec package %{name}, in the format %{name}.spec. [x]: File names are valid UTF-8. [x]: Packages must not store files under /srv, /opt or /usr/local [x]: Package successfully compiles and builds into binary rpms on at least one supported primary architecture. [x]: Package installs properly. [x]: Rpmlint is run on all rpms the build produces. Note: There are rpmlint messages (see attachment). Java: [x]: Fully versioned dependency in subpackages, if present. Maven: [-]: If package contains pom.xml files install it (including depmaps) even when building with ant [x]: Old add_to_maven_depmap macro is not being used Perl: [-]: Package contains the mandatory BuildRequires and Requires:. Note: Requires: perl(:MODULE_COMPAT_%(eval "`%{__perl} -V:version`"; echo $version)) missing? - It is not perl module, thus it's probably OK. ===== SHOULD items ===== Generic: [-]: Packager, Vendor, PreReq, Copyright tags should not be in spec file Note: Found : Packager: Jaroslav Škarvada <jskarvad> Long standing fedora-review bug :), already reported. [x]: If the source package does not include license text(s) as a separate file from upstream, the packager SHOULD query upstream to include it. [!]: Final provides and requires are sane (see attachments). - See attachment. [x]: Package functions as described. - I only tried a simple check from comment 2. [x]: Latest version is packaged. [x]: Package does not include license text files separate from upstream. [x]: Patches link to upstream bugs/comments/lists or are otherwise justified. [-]: Description and summary sections in the package spec file contains translations for supported Non-English languages, if available. [x]: Package should compile and build into binary rpms on all supported architectures. - Checked x86_64, i686, armv7hl. [!]: %check is present and all tests pass. - You should run the make check. [!]: Packages should try to preserve timestamps of original installed files. - You should use install -p. [x]: Sources can be downloaded from URI in Source: tag [x]: Reviewer should test that the package builds in mock. [x]: Buildroot is not present [x]: Package has no %clean section with rm -rf %{buildroot} (or $RPM_BUILD_ROOT) [x]: Dist tag is present. [x]: No file requires outside of /etc, /bin, /sbin, /usr/bin, /usr/sbin. [x]: Uses parallel make. [x]: SourceX tarball generation or download is documented. [x]: SourceX is a working URL. [x]: Spec use %global instead of %define. Java: [-]: Packages are noarch unless they use JNI Note: ncbi-blast+ subpackage is not noarch. Please verify manually [-]: Package uses upstream build method (ant/maven/etc.) ===== EXTRA items ===== Generic: [x]: Large data in /usr/share should live in a noarch subpackage if package is arched. [x]: Rpmlint is run on all installed packages. Note: There are rpmlint messages (see attachment). [x]: Spec file according to URL is the same as in SRPM. Rpmlint ------- Checking: ncbi-blast+-2.2.28-1.fc18.x86_64.rpm ncbi-blast+.x86_64: W: spelling-error %description -l en_US nucleotide -> nucleation ncbi-blast+.x86_64: W: no-manual-page-for-binary psiblast ncbi-blast+.x86_64: W: no-manual-page-for-binary dustmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary update_blastdb.pl ncbi-blast+.x86_64: W: no-manual-page-for-binary convert2blastmask ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdb_aliastool ncbi-blast+.x86_64: W: no-manual-page-for-binary legacy_blast.pl ncbi-blast+.x86_64: W: no-manual-page-for-binary makeblastdb ncbi-blast+.x86_64: W: no-manual-page-for-binary makembindex ncbi-blast+.x86_64: W: no-manual-page-for-binary blast_formatter ncbi-blast+.x86_64: W: no-manual-page-for-binary windowmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary tblastn ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdbcheck ncbi-blast+.x86_64: W: no-manual-page-for-binary tblastx ncbi-blast+.x86_64: W: no-manual-page-for-binary blastx ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdbcmd ncbi-blast+.x86_64: W: no-manual-page-for-binary segmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary blastp ncbi-blast+.x86_64: W: no-manual-page-for-binary blastn ncbi-blast+.x86_64: W: no-manual-page-for-binary makeprofiledb ncbi-blast+.x86_64: W: no-manual-page-for-binary rpsblast ncbi-blast+.x86_64: W: no-manual-page-for-binary rpstblastn ncbi-blast+.x86_64: W: no-manual-page-for-binary deltablast 1 packages and 0 specfiles checked; 0 errors, 23 warnings. - OK, no manual pages exist. Rpmlint (installed packages) ---------------------------- # rpmlint ncbi-blast+ ncbi-blast+.x86_64: W: spelling-error %description -l en_US nucleotide -> nucleoli ncbi-blast+.x86_64: W: no-manual-page-for-binary psiblast ncbi-blast+.x86_64: W: no-manual-page-for-binary dustmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary update_blastdb.pl ncbi-blast+.x86_64: W: no-manual-page-for-binary convert2blastmask ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdb_aliastool ncbi-blast+.x86_64: W: no-manual-page-for-binary legacy_blast.pl ncbi-blast+.x86_64: W: no-manual-page-for-binary makeblastdb ncbi-blast+.x86_64: W: no-manual-page-for-binary makembindex ncbi-blast+.x86_64: W: no-manual-page-for-binary blast_formatter ncbi-blast+.x86_64: W: no-manual-page-for-binary windowmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary tblastn ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdbcheck ncbi-blast+.x86_64: W: no-manual-page-for-binary tblastx ncbi-blast+.x86_64: W: no-manual-page-for-binary blastx ncbi-blast+.x86_64: W: no-manual-page-for-binary blastdbcmd ncbi-blast+.x86_64: W: no-manual-page-for-binary segmasker ncbi-blast+.x86_64: W: no-manual-page-for-binary blastp ncbi-blast+.x86_64: W: no-manual-page-for-binary blastn ncbi-blast+.x86_64: W: no-manual-page-for-binary makeprofiledb ncbi-blast+.x86_64: W: no-manual-page-for-binary rpsblast ncbi-blast+.x86_64: W: no-manual-page-for-binary rpstblastn ncbi-blast+.x86_64: W: no-manual-page-for-binary deltablast 1 packages and 0 specfiles checked; 0 errors, 23 warnings. # echo 'rpmlint-done:' - OK, no manual pages exist. Jar and class files in source ----------------------------- ./ncbi-blast-2.2.28+-src/c++/src/build-system/project_tree_builder_gui/bin/lib/swing-layout-1.0.4.jar ./ncbi-blast-2.2.28+-src/c++/src/build-system/project_tree_builder_gui/bin/lib/swing-layout-1.0.3.jar ./ncbi-blast-2.2.28+-src/c++/src/build-system/project_tree_builder_gui/bin/ptbgui.jar - They are not packaged, but I would prefer to rm it in the %prep. Requires -------- ncbi-blast+ (rpmlib, GLIBC filtered): /usr/bin/perl ld-linux-x86-64.so.2()(64bit) libalign_format.so()(64bit) libbiblio.so()(64bit) libblast.so()(64bit) libblast_services.so()(64bit) libblastdb.so()(64bit) libblastdb_format.so()(64bit) libblastinput.so()(64bit) libblastxml.so()(64bit) libbz2.so.1()(64bit) libc.so.6()(64bit) libcomposition_adjustment.so()(64bit) libcreaders.so()(64bit) libdl.so.2()(64bit) libentrez2.so()(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.3.1)(64bit) libgcc_s.so.1(GCC_3.4)(64bit) libgcc_s.so.1(GCC_4.0.0)(64bit) libgene_info.so()(64bit) libgeneral.so()(64bit) libgenome_collection.so()(64bit) libid1.so()(64bit) libid2.so()(64bit) libm.so.6()(64bit) libmedline.so()(64bit) libncbi_xloader_blastdb.so()(64bit) libncbi_xloader_blastdb_rmt.so()(64bit) libncbi_xloader_genbank.so()(64bit) libncbi_xreader.so()(64bit) libncbi_xreader_cache.so()(64bit) libncbi_xreader_id1.so()(64bit) libncbi_xreader_id2.so()(64bit) libnsl.so.1()(64bit) libpcre.so.1()(64bit) libpthread.so.0()(64bit) libpub.so()(64bit) librt.so.1()(64bit) libscoremat.so()(64bit) libseq.so()(64bit) libseqcode.so()(64bit) libseqdb.so()(64bit) libseqedit.so()(64bit) libseqmasks_io.so()(64bit) libseqset.so()(64bit) libseqsplit.so()(64bit) libsequtil.so()(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.1)(64bit) libtables.so()(64bit) libtaxon1.so()(64bit) libvariation.so()(64bit) libwritedb.so()(64bit) libxalgoblastdbindex.so()(64bit) libxalgodustmask.so()(64bit) libxalgosegmask.so()(64bit) libxalgowinmask.so()(64bit) libxalnmgr.so()(64bit) libxblast.so()(64bit) libxblastformat.so()(64bit) libxcgi.so()(64bit) libxcompress.so()(64bit) libxconnect.so()(64bit) libxconnext.so()(64bit) libxhtml.so()(64bit) libxncbi.so()(64bit) libxnetblast.so()(64bit) libxnetblastcli.so()(64bit) libxobjmgr.so()(64bit) libxobjread.so()(64bit) libxobjsimple.so()(64bit) libxobjutil.so()(64bit) libxser.so()(64bit) libxutil.so()(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0)(64bit) perl(Archive::Tar) perl(Digest::MD5) perl(File::Temp) perl(File::stat) perl(Getopt::Long) perl(Net::FTP) perl(Pod::Usage) perl(constant) perl(strict) perl(warnings) rtld(GNU_HASH) Provides -------- ncbi-blast+: libalign_format.so()(64bit) libbiblio.so()(64bit) libblast.so()(64bit) libblast_services.so()(64bit) libblastdb.so()(64bit) libblastdb_format.so()(64bit) libblastinput.so()(64bit) libblastxml.so()(64bit) libcomposition_adjustment.so()(64bit) libcreaders.so()(64bit) libentrez2.so()(64bit) libentrez2cli.so()(64bit) libgene_info.so()(64bit) libgeneral.so()(64bit) libgenome_collection.so()(64bit) libid1.so()(64bit) libid2.so()(64bit) libid2_split.so()(64bit) libigblast.so()(64bit) libmedline.so()(64bit) libncbi_xloader_blastdb.so()(64bit) libncbi_xloader_blastdb_rmt.so()(64bit) libncbi_xloader_genbank.so()(64bit) libncbi_xreader.so()(64bit) libncbi_xreader_cache.so()(64bit) libncbi_xreader_id1.so()(64bit) libncbi_xreader_id2.so()(64bit) libpub.so()(64bit) libscoremat.so()(64bit) libseq.so()(64bit) libseqcode.so()(64bit) libseqdb.so()(64bit) libseqedit.so()(64bit) libseqmasks_io.so()(64bit) libseqset.so()(64bit) libseqsplit.so()(64bit) libsequtil.so()(64bit) libsubmit.so()(64bit) libtables.so()(64bit) libtaxon1.so()(64bit) libtest_boost.so()(64bit) libtest_mt.so()(64bit) libvariation.so()(64bit) libwritedb.so()(64bit) libxalgoblastdbindex.so()(64bit) libxalgodustmask.so()(64bit) libxalgosegmask.so()(64bit) libxalgowinmask.so()(64bit) libxalnmgr.so()(64bit) libxblast.so()(64bit) libxblastformat.so()(64bit) libxcgi.so()(64bit) libxcompress.so()(64bit) libxconnect.so()(64bit) libxconnext.so()(64bit) libxhtml.so()(64bit) libxncbi.so()(64bit) libxnetblast.so()(64bit) libxnetblastcli.so()(64bit) libxobjmgr.so()(64bit) libxobjread.so()(64bit) libxobjsimple.so()(64bit) libxobjutil.so()(64bit) libxregexp.so()(64bit) libxser.so()(64bit) libxutil.so()(64bit) ncbi-blast+ ncbi-blast+(x86-64) - I think the private libs shouldn't be provided / required https://fedoraproject.org/wiki/Packaging:AutoProvidesAndRequiresFiltering If they are not private, they should be versioned and known to the linker (i.e. ld config file needs to be shipped and the ldconfig called in post*) Unversioned so-files -------------------- ncbi-blast+: /usr/lib64/ncbi-blast+/libalign_format.so ncbi-blast+: /usr/lib64/ncbi-blast+/libbiblio.so ncbi-blast+: /usr/lib64/ncbi-blast+/libblast.so ncbi-blast+: /usr/lib64/ncbi-blast+/libblast_services.so ncbi-blast+: /usr/lib64/ncbi-blast+/libblastdb.so ncbi-blast+: /usr/lib64/ncbi-blast+/libblastdb_format.so ncbi-blast+: /usr/lib64/ncbi-blast+/libblastinput.so ncbi-blast+: /usr/lib64/ncbi-blast+/libblastxml.so ncbi-blast+: /usr/lib64/ncbi-blast+/libcomposition_adjustment.so ncbi-blast+: /usr/lib64/ncbi-blast+/libcreaders.so ncbi-blast+: /usr/lib64/ncbi-blast+/libentrez2.so ncbi-blast+: /usr/lib64/ncbi-blast+/libentrez2cli.so ncbi-blast+: /usr/lib64/ncbi-blast+/libgene_info.so ncbi-blast+: /usr/lib64/ncbi-blast+/libgeneral.so ncbi-blast+: /usr/lib64/ncbi-blast+/libgenome_collection.so ncbi-blast+: /usr/lib64/ncbi-blast+/libid1.so ncbi-blast+: /usr/lib64/ncbi-blast+/libid2.so ncbi-blast+: /usr/lib64/ncbi-blast+/libid2_split.so ncbi-blast+: /usr/lib64/ncbi-blast+/libigblast.so ncbi-blast+: /usr/lib64/ncbi-blast+/libmedline.so ncbi-blast+: /usr/lib64/ncbi-blast+/libncbi_xloader_blastdb.so ncbi-blast+: /usr/lib64/ncbi-blast+/libncbi_xloader_blastdb_rmt.so ncbi-blast+: /usr/lib64/ncbi-blast+/libncbi_xloader_genbank.so ncbi-blast+: /usr/lib64/ncbi-blast+/libncbi_xreader.so ncbi-blast+: /usr/lib64/ncbi-blast+/libncbi_xreader_cache.so ncbi-blast+: /usr/lib64/ncbi-blast+/libncbi_xreader_id1.so ncbi-blast+: /usr/lib64/ncbi-blast+/libncbi_xreader_id2.so ncbi-blast+: /usr/lib64/ncbi-blast+/libpub.so ncbi-blast+: /usr/lib64/ncbi-blast+/libscoremat.so ncbi-blast+: /usr/lib64/ncbi-blast+/libseq.so ncbi-blast+: /usr/lib64/ncbi-blast+/libseqcode.so ncbi-blast+: /usr/lib64/ncbi-blast+/libseqdb.so ncbi-blast+: /usr/lib64/ncbi-blast+/libseqedit.so ncbi-blast+: /usr/lib64/ncbi-blast+/libseqmasks_io.so ncbi-blast+: /usr/lib64/ncbi-blast+/libseqset.so ncbi-blast+: /usr/lib64/ncbi-blast+/libseqsplit.so ncbi-blast+: /usr/lib64/ncbi-blast+/libsequtil.so ncbi-blast+: /usr/lib64/ncbi-blast+/libsubmit.so ncbi-blast+: /usr/lib64/ncbi-blast+/libtables.so ncbi-blast+: /usr/lib64/ncbi-blast+/libtaxon1.so ncbi-blast+: /usr/lib64/ncbi-blast+/libtest_boost.so ncbi-blast+: /usr/lib64/ncbi-blast+/libtest_mt.so ncbi-blast+: /usr/lib64/ncbi-blast+/libvariation.so ncbi-blast+: /usr/lib64/ncbi-blast+/libwritedb.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxalgoblastdbindex.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxalgodustmask.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxalgosegmask.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxalgowinmask.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxalnmgr.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxblast.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxblastformat.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxcgi.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxcompress.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxconnect.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxconnext.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxhtml.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxncbi.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxnetblast.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxnetblastcli.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxobjmgr.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxobjread.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxobjsimple.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxobjutil.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxregexp.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxser.so ncbi-blast+: /usr/lib64/ncbi-blast+/libxutil.so - Probably OK, internally used, not intended for external use. Source checksums ---------------- ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/ncbi-blast-2.2.28+-src.tar.gz : CHECKSUM(SHA256) this package : 8f0610251d61973e720276029a26da8baedec474ca12016bde11483491631f60 CHECKSUM(SHA256) upstream package : 8f0610251d61973e720276029a26da8baedec474ca12016bde11483491631f60 Generated by fedora-review 0.4.1 (b2e211f) last change: 2013-04-29 Buildroot used: fedora-18-x86_64 Command line :/usr/bin/fedora-review -n ncbi-blast+ To sum: - I would remove the unused / bundled content in the %prep. - You should run the make check. - You should use install -p. - Private libs shouldn't be provided / required or do not ship them as private.
I think I have fixed everything except "make check". The problem here is that it runs out-dated queries against the online database at <blast.ncbi.nlm.nih.gov/Blast.cgi>. The database gets updated faster then the releases happen which is causing some tests to fail. Debian maintainer has the tests commented out too because of this. Spec URL: http://jkaluza.fedorapeople.org/ncbi-blast+.spec SRPM URL: http://jkaluza.fedorapeople.org/ncbi-blast+-2.2.28-1.fc19.src.rpm
OK, thanks, giving fedora-review+.
New Package SCM Request ======================= Package Name: ncbi-blast+ Short Description: NCBI BLAST+ finds regions of similarity between biological sequences Owners: jkaluza Branches: f18 f19 f20 InitialCC:
Git done (by process-git-requests).
ncbi-blast+-2.2.28-1.fc19 has been submitted as an update for Fedora 19. https://admin.fedoraproject.org/updates/ncbi-blast+-2.2.28-1.fc19
ncbi-blast+-2.2.28-1.fc18 has been submitted as an update for Fedora 18. https://admin.fedoraproject.org/updates/ncbi-blast+-2.2.28-1.fc18
ncbi-blast+-2.2.28-1.fc18 has been pushed to the Fedora 18 testing repository.
ncbi-blast+-2.2.28-1.fc18 has been pushed to the Fedora 18 stable repository.
ncbi-blast+-2.2.28-1.fc19 has been pushed to the Fedora 19 stable repository.